chordgitar bidadari kesleo - nella kharisma - Hallo sahabat Chord Gitar Terlengkap, Pada Artikel yang anda baca kali ini dengan judul chord gitar bidadari kesleo - nella kharisma, kami telah mempersiapkan artikel ini dengan baik untuk anda baca dan ambil informasi didalamnya. mudah-mudahan isi postingan Artikel nella kharisma, yang kami tulis ini dapat anda pahami. baiklah, selamat membaca.album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNFNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNEmNNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNNDNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNGNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNGNNNNNNNNNEmNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNGNNNNNNNNNEmNNNNNNNNCNNNNNNNNDNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login NellaKharisma - Bidadari Kesleo Huda. Facebook Twitter. Chord Gitar Nella Kharisma - Bidadari Kesleo dan Liriknya [Intro] G Em C D G Em Untumu.. ono kawate C D Ono lomboke, ono kangkunge G Em Yen mrenges.. ketok aslimu C D Ketok wagumu.. ketok mrongosmu [Reff] G Bidadari keseleo
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCCCCCAmCCCCCCCCCFmCCCCCmCCCDCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCFCCCCCCmCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCFCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCFCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCCCFCCCCGCCCCCCCACCCCCCCFCCCCCCCCCCCCmCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCDCCCCCCCCmCCCCCCCGCCCCCCCACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
31 500 Lagu Pop Terbaru APK تنزيل للاندرويد أفضل 500 أغنية البوب الاندونيسية أحدث وأفضل اختيار من 2018
ChordNella Kharisma Bidadari Kesleo Intro: G Em C D G Em Untumu.. ono kawate C D Ketok wagumu.. ketok mrongosmu Reff: G Bidadari keseleo G mekso-mekso banget Em nganggo kawat abang ijo Em Pupure medok mirok C katon kandel separo C Dowo untune koyo sungai D bengawan solo, solo G Bidadari kesleo G ngempet ngempet banget Em dadi pengen nduwe
Lirik Dan Chord Lagu Via Vallen - Bidadari Kesleo INTRO G Em C D G Em Untumu.. ono kawate C D Ono lomboke, ono kangkunge G Em Yen mrenges.. ketok aslimu C D Ketok wagumu.. ketok mrongosmu G Bidadari keseleo G mekso-mekso banget Em nganggo kawat abang ijo Em Pupure medok mirok C katon kandel separo C Dowo untune koyo sungai D bengawan solo, solo G Bidadari kesleo G ngempet ngempet banget Em dadi pengen nduwe bojo Em Opo mungkin samar C yen ora keduman jodoh C Lan opo mungkin amung arep D pengen mlekoto, koto G Em Sing tenang.. ben iso mikir C D Ra usah sumelang.. ojo kuwatir.. G Em Sing penting.. lurus mlakumu C D Ayu atimu.. Ayu sifatmu.. *Kembali ke atasDownload& View Chord Bidadari Kesleo as PDF for free. More details. Words: 117; Pages: 2; Preview; Full text; bidadari kesleo intro:c am f g c am untumu ono kawate f g ono lomboke,ono kangkunge c am yen mrenges,ketok aslimu f g ketok wagumu,ketok mrongosmu # c am bidadari keseleo mekso-mekso banget nganggo kawat abang ijo f pupure medok mirok
© Chordvisa Powered by Blogger
gLD8iS.